ID: 1029238827_1029238850

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1029238827 1029238850
Species Human (GRCh38) Human (GRCh38)
Location 7:99144138-99144160 7:99144188-99144210
Sequence CCGGCCCGGCCCTGCGCGCCCCC ACGTACGCTGGGGCGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 26, 3: 218, 4: 1346} {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!