ID: 1029238833_1029238844

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1029238833 1029238844
Species Human (GRCh38) Human (GRCh38)
Location 7:99144157-99144179 7:99144182-99144204
Sequence CCCCGCGCCTGCGTGCGTGCGCG CCCGCCACGTACGCTGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 111} {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!