ID: 1029405973_1029405982

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1029405973 1029405982
Species Human (GRCh38) Human (GRCh38)
Location 7:100374133-100374155 7:100374170-100374192
Sequence CCCTTCTCCTTCTATTACCCCTG CTCCCGACGTGAGAATATCCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 4, 3: 37, 4: 495} {0: 1, 1: 0, 2: 1, 3: 1, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!