ID: 1029629613_1029629628

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1029629613 1029629628
Species Human (GRCh38) Human (GRCh38)
Location 7:101742355-101742377 7:101742392-101742414
Sequence CCCTCCCCTTTTCTAACTCCAAA AGCCGTGTTTGGAGAAGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!