ID: 1029629927_1029629945

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1029629927 1029629945
Species Human (GRCh38) Human (GRCh38)
Location 7:101743847-101743869 7:101743891-101743913
Sequence CCTCCATGAGGCCTCTCACACCC CCCCAAAGCCCACTCTCCGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!