ID: 1029679190_1029679199

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029679190 1029679199
Species Human (GRCh38) Human (GRCh38)
Location 7:102096268-102096290 7:102096308-102096330
Sequence CCGCTAACCCCTGACTCTTCTGA AGGAGGATCGTAATGGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 238} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!