ID: 1029737673_1029737686

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1029737673 1029737686
Species Human (GRCh38) Human (GRCh38)
Location 7:102473659-102473681 7:102473712-102473734
Sequence CCTTCCTGCTTGTCTTTTATGGC GAGCTGGAACAGCTGGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 242} {0: 2, 1: 1, 2: 7, 3: 73, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!