ID: 1029759274_1029759277

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1029759274 1029759277
Species Human (GRCh38) Human (GRCh38)
Location 7:102592281-102592303 7:102592294-102592316
Sequence CCACCTTGGAGCTGGGCGTCTTC GGGCGTCTTCGCGAAGCTGAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 9, 4: 147} {0: 4, 1: 0, 2: 0, 3: 0, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!