ID: 1029759608_1029759618

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1029759608 1029759618
Species Human (GRCh38) Human (GRCh38)
Location 7:102593701-102593723 7:102593742-102593764
Sequence CCGCACCTTGGCCAACAGGAGCA CGTCCGCGTGGCGCTCCCGCAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 34, 4: 427} {0: 4, 1: 0, 2: 0, 3: 5, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!