ID: 1029773220_1029773221

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1029773220 1029773221
Species Human (GRCh38) Human (GRCh38)
Location 7:102668775-102668797 7:102668790-102668812
Sequence CCAAGATTATAAAATGCCCAGAG GCCCAGAGCAAGCCCCCAGAAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 17, 4: 197} {0: 4, 1: 0, 2: 2, 3: 20, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!