ID: 1030107176_1030107183

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1030107176 1030107183
Species Human (GRCh38) Human (GRCh38)
Location 7:105996927-105996949 7:105996963-105996985
Sequence CCTGGCACTATCCCAGGCACAAA CCTATTGTAGATGGGGATTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 96, 4: 1139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!