ID: 1030107178_1030107186

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1030107178 1030107186
Species Human (GRCh38) Human (GRCh38)
Location 7:105996939-105996961 7:105996976-105996998
Sequence CCAGGCACAAAATGAAGATCTGA GGGATTTAGGAGGAAAAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!