ID: 1030695256_1030695265

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1030695256 1030695265
Species Human (GRCh38) Human (GRCh38)
Location 7:112578083-112578105 7:112578114-112578136
Sequence CCTGACTCCTATCACCATCAGTG AAGGAATAATTTGGGAATTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 31, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!