ID: 1031243857_1031243869

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1031243857 1031243869
Species Human (GRCh38) Human (GRCh38)
Location 7:119281647-119281669 7:119281692-119281714
Sequence CCCCCAGTCACTGTGCTCTCCCT TCCACCACACGGCTGCTGCCAGG
Strand - +
Off-target summary {0: 17, 1: 31, 2: 74, 3: 156, 4: 510} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!