ID: 1031862187_1031862198

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1031862187 1031862198
Species Human (GRCh38) Human (GRCh38)
Location 7:126993626-126993648 7:126993674-126993696
Sequence CCCAGAAATAATTACATGGCATA AGGGAGAGCACAGTGACTGGGGG
Strand - +
Off-target summary No data {0: 17, 1: 31, 2: 74, 3: 156, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!