ID: 1031862187_1031862198 |
View in Genome Browser |
Spacer: 25 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1031862187 | 1031862198 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:126993626-126993648 | 7:126993674-126993696 |
Sequence | CCCAGAAATAATTACATGGCATA | AGGGAGAGCACAGTGACTGGGGG |
Strand | - | + |
Off-target summary | No data | {0: 17, 1: 31, 2: 74, 3: 156, 4: 510} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |