ID: 1031959618_1031959626

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1031959618 1031959626
Species Human (GRCh38) Human (GRCh38)
Location 7:127976874-127976896 7:127976912-127976934
Sequence CCGTGGAGGCAGGAAACCTTTGC CTCCCCTACATGGTGTCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 188} {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!