ID: 1032027564_1032027577

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1032027564 1032027577
Species Human (GRCh38) Human (GRCh38)
Location 7:128455786-128455808 7:128455835-128455857
Sequence CCGGGCGTGCGTGCGGCCTCCAG GTGCTCGCGGCTATAAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120} {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!