ID: 1032795382_1032795384

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1032795382 1032795384
Species Human (GRCh38) Human (GRCh38)
Location 7:135271957-135271979 7:135271973-135271995
Sequence CCGGGTTTTGTAAACAGCATTAT GCATTATGAGTTCACAGACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 12, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!