ID: 1032801814_1032801819

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1032801814 1032801819
Species Human (GRCh38) Human (GRCh38)
Location 7:135322862-135322884 7:135322891-135322913
Sequence CCAAATTGACTCTTTGTTTTTTA TAAAGTTTGAATGGCTTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 920} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!