ID: 1032841176_1032841184

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1032841176 1032841184
Species Human (GRCh38) Human (GRCh38)
Location 7:135714609-135714631 7:135714639-135714661
Sequence CCCACGGGCCCGCATGCAGAGGA GCCTCCATGGCGAGGAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49} {0: 1, 1: 0, 2: 0, 3: 25, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!