ID: 1033294229_1033294235

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1033294229 1033294235
Species Human (GRCh38) Human (GRCh38)
Location 7:140115464-140115486 7:140115498-140115520
Sequence CCTTGGGATGCTGTTAATCTATG AACCCCGTGCTCTCTGAAACAGG
Strand - +
Off-target summary {0: 31, 1: 644, 2: 459, 3: 1481, 4: 453} {0: 8, 1: 7, 2: 3, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!