ID: 1033573437_1033573445

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1033573437 1033573445
Species Human (GRCh38) Human (GRCh38)
Location 7:142656714-142656736 7:142656741-142656763
Sequence CCTCCATCCTGCCTCTTCATGCC CCTCCCTGCTCTTCTTCTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 40, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!