ID: 1033583020_1033583023

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1033583020 1033583023
Species Human (GRCh38) Human (GRCh38)
Location 7:142753604-142753626 7:142753635-142753657
Sequence CCTAGTTCCATCTCTGTGAGCAG GATGTTCCACCTACCATAGCAGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 0, 3: 28, 4: 207} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!