ID: 1033747400_1033747404

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1033747400 1033747404
Species Human (GRCh38) Human (GRCh38)
Location 7:144332066-144332088 7:144332087-144332109
Sequence CCATGGAAATGCAGCTCCCATGG GGCCACCCACACTTCCACCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 31, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!