|
Left Crispr |
Right Crispr |
| Crispr ID |
1033951982 |
1033951992 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:146796340-146796362
|
7:146796368-146796390
|
| Sequence |
CCATCTCCCTGAGGAGTTCTGGG |
GTTTTTAAGGGGATTGTGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 18, 2: 42, 3: 87, 4: 388} |
{0: 6, 1: 27, 2: 45, 3: 72, 4: 290} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|