|
Left Crispr |
Right Crispr |
| Crispr ID |
1033962884 |
1033962886 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:146935501-146935523
|
7:146935526-146935548
|
| Sequence |
CCTTCACTCTTCTAGAAGGGCAT |
TTTGTTAGGTACTTTTTCCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 53, 2: 41, 3: 37, 4: 140} |
{0: 1, 1: 40, 2: 49, 3: 45, 4: 260} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|