ID: 1033967097_1033967105

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1033967097 1033967105
Species Human (GRCh38) Human (GRCh38)
Location 7:146989310-146989332 7:146989327-146989349
Sequence CCCTTCAGTACTGGCCTGTGTTG GTGTTGGGGTGATGGGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144} {0: 1, 1: 1, 2: 4, 3: 40, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!