ID: 1033967104_1033967106

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1033967104 1033967106
Species Human (GRCh38) Human (GRCh38)
Location 7:146989324-146989346 7:146989345-146989367
Sequence CCTGTGTTGGGGTGATGGGACTG TGAGGCTTTTGTCTCCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 307} {0: 1, 1: 0, 2: 1, 3: 20, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!