ID: 1034107238_1034107247

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1034107238 1034107247
Species Human (GRCh38) Human (GRCh38)
Location 7:148500944-148500966 7:148500988-148501010
Sequence CCCCCTACAATGCCTCCTCCATG CTTGAAACCCAGAGGGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!