ID: 1034147309_1034147322

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1034147309 1034147322
Species Human (GRCh38) Human (GRCh38)
Location 7:148884394-148884416 7:148884436-148884458
Sequence CCGCCGGGCTCGGAGGCGCCGAG GCTCAGGGCTCGTGGGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93} {0: 1, 1: 0, 2: 3, 3: 16, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!