ID: 1034147314_1034147327

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1034147314 1034147327
Species Human (GRCh38) Human (GRCh38)
Location 7:148884421-148884443 7:148884465-148884487
Sequence CCCCACGCAGAGTGCGCTCAGGG GCAGCGCGTGCGCGCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 151} {0: 1, 1: 0, 2: 3, 3: 27, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!