ID: 1034147316_1034147329

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034147316 1034147329
Species Human (GRCh38) Human (GRCh38)
Location 7:148884422-148884444 7:148884471-148884493
Sequence CCCACGCAGAGTGCGCTCAGGGC CGTGCGCGCGCGGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 76} {0: 1, 1: 1, 2: 8, 3: 93, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!