ID: 1034219337_1034219340

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1034219337 1034219340
Species Human (GRCh38) Human (GRCh38)
Location 7:149431973-149431995 7:149431994-149432016
Sequence CCAGGAGGTGGTGCTTGCGGATG TGAAGCTCTTGCCGCACTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 792} {0: 2, 1: 4, 2: 13, 3: 29, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!