ID: 1034235993_1034235999

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1034235993 1034235999
Species Human (GRCh38) Human (GRCh38)
Location 7:149569910-149569932 7:149569942-149569964
Sequence CCCTAGCGGGAGGGGAAGGAGAG GCAGTGTAGGTGGCTGGCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 108, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!