ID: 1034275979_1034275994

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1034275979 1034275994
Species Human (GRCh38) Human (GRCh38)
Location 7:149824053-149824075 7:149824101-149824123
Sequence CCCTTAGTCTACCCTGACTACCC GGAGCTGCACTGCACCAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!