ID: 1034466418_1034466439

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1034466418 1034466439
Species Human (GRCh38) Human (GRCh38)
Location 7:151232608-151232630 7:151232658-151232680
Sequence CCGCTCTTGGTCCCCACGCCTCC GACCCCGGCCGTCCTTTATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 375, 4: 665} {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!