ID: 1034466441_1034466451

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1034466441 1034466451
Species Human (GRCh38) Human (GRCh38)
Location 7:151232661-151232683 7:151232689-151232711
Sequence CCCGGCCGTCCTTTATCCGGTGT GGCCCCCGGCCCTGAAACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 18} {0: 1, 1: 0, 2: 2, 3: 20, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!