ID: 1034655214_1034655216

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1034655214 1034655216
Species Human (GRCh38) Human (GRCh38)
Location 7:152723691-152723713 7:152723717-152723739
Sequence CCAGAAAGGCCAGGCATGGTAGC TGCTTGCAATCCCAGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 33, 3: 148, 4: 724} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!