ID: 1034946631_1034946638

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1034946631 1034946638
Species Human (GRCh38) Human (GRCh38)
Location 7:155266663-155266685 7:155266686-155266708
Sequence CCTCTGGCCTCCAGGTGGATTCA GTCACAGCAGAAGCTGGGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!