ID: 1035019725_1035019742

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1035019725 1035019742
Species Human (GRCh38) Human (GRCh38)
Location 7:155793867-155793889 7:155793906-155793928
Sequence CCCAGGGACCCACCTGCTCCTTG CAGGCTGCAGGAGGGGCAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 17, 3: 181, 4: 1135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!