ID: 1035067847_1035067857

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1035067847 1035067857
Species Human (GRCh38) Human (GRCh38)
Location 7:156121265-156121287 7:156121294-156121316
Sequence CCCTCAGAGGCGCTGTGTGAAAG CAAGGAATGGTCGGGGGAGCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!