ID: 1035068271_1035068285

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1035068271 1035068285
Species Human (GRCh38) Human (GRCh38)
Location 7:156123370-156123392 7:156123406-156123428
Sequence CCCAGAAGGACCCGCCATCTCCC AGTGGTACTGTGGAAACTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!