ID: 1035171240_1035171251

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1035171240 1035171251
Species Human (GRCh38) Human (GRCh38)
Location 7:157018475-157018497 7:157018502-157018524
Sequence CCTTCCCGCCTGAGAAGCGTCCA GAGTTCCAGGCCGGGCGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 48, 3: 485, 4: 3036}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!