ID: 1035324366_1035324374 |
View in Genome Browser |
Spacer: 25 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1035324366 | 1035324374 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:158055429-158055451 | 7:158055477-158055499 |
Sequence | CCCTGGGGGAGTTTAGAGAAGAC | CAGGCCCACCCGCAGTTATCCGG |
Strand | - | + |
Off-target summary | {0: 45, 1: 118, 2: 86, 3: 32, 4: 166} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |