ID: 1035324366_1035324374

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1035324366 1035324374
Species Human (GRCh38) Human (GRCh38)
Location 7:158055429-158055451 7:158055477-158055499
Sequence CCCTGGGGGAGTTTAGAGAAGAC CAGGCCCACCCGCAGTTATCCGG
Strand - +
Off-target summary {0: 45, 1: 118, 2: 86, 3: 32, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!