ID: 1035413804_1035413817

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1035413804 1035413817
Species Human (GRCh38) Human (GRCh38)
Location 7:158667425-158667447 7:158667458-158667480
Sequence CCCTCCGCCCTCCTTACCCACTA CCGCCCGCCTTACCCACTACTGG
Strand - +
Off-target summary No data {0: 3, 1: 9, 2: 3, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!