ID: 1035413804_1035413818

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1035413804 1035413818
Species Human (GRCh38) Human (GRCh38)
Location 7:158667425-158667447 7:158667459-158667481
Sequence CCCTCCGCCCTCCTTACCCACTA CGCCCGCCTTACCCACTACTGGG
Strand - +
Off-target summary {0: 9, 1: 6, 2: 2, 3: 29, 4: 278} {0: 3, 1: 9, 2: 3, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!