ID: 1035413864_1035413876

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1035413864 1035413876
Species Human (GRCh38) Human (GRCh38)
Location 7:158667598-158667620 7:158667629-158667651
Sequence CCCTCCGCCCTCCTTACCTACCC TCCACCCTCTTACCCACTACTGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 3, 3: 56, 4: 1029} {0: 3, 1: 1, 2: 0, 3: 16, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!