ID: 1035414003_1035414017

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1035414003 1035414017
Species Human (GRCh38) Human (GRCh38)
Location 7:158668002-158668024 7:158668037-158668059
Sequence CCCTCCGCCCTCCTTACCCACTA GCCCTCCCTTACCCACTACTGGG
Strand - +
Off-target summary {0: 9, 1: 6, 2: 2, 3: 29, 4: 277} {0: 6, 1: 3, 2: 0, 3: 12, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!