ID: 1035470413_1035470415

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1035470413 1035470415
Species Human (GRCh38) Human (GRCh38)
Location 7:159105634-159105656 7:159105653-159105675
Sequence CCAATCAGGGGCTCTGACTACAA ACAAGGCCCACACCTCACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89} {0: 1, 1: 0, 2: 0, 3: 17, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!