ID: 1035470413_1035470422

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1035470413 1035470422
Species Human (GRCh38) Human (GRCh38)
Location 7:159105634-159105656 7:159105672-159105694
Sequence CCAATCAGGGGCTCTGACTACAA CAGGGAGCCCCAGCAGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89} {0: 1, 1: 1, 2: 5, 3: 51, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!